Tax Names: Annelida, Clitellata, Haplotaxida, Octochaetidae, Eutyphoeus, Eutyphoeus scutarius

Taxon: Eutyphoeus scutarius

Illustrative Barcode

Nucleotide Sequence

AACATTATATTTTATTCTTGGGGTCTGAGCCGGAATAATTGGAGCCGGCATAAGAATTCTTATTCGGGTAGAACTAAGACAACCGGGTGCATTCTTAGGTAGAGACCAACTCTACAATACCATTGTTACAGCTCACGCTTTCTTAATAATTTTTTTTCTTGTAATACCAGTATTCATTGGCGGATTCGGAAACTGATTATTACCACTAATACTCGGAGCACCAGATATGGCATTCCCACGACTAAATAATCTAAGATTCTGATTACTACCTCCATCACTTATCTTATTAGTTTCGTCTGCAGCAGTAGAAAAGGGAGCGGGAACAGGATGAACTGTATACCCGCCACTAGCAAGAAATATTGCTCACGCTGGGCCATCAGTAGATCTAGCAATCTTCTCACTACACTTAGCTGGGGCCTCCTCTATTCTTGGAGCTATCAACTTCATTACAACAGTAATTAATATACGATGAACAGGACTACGACTAGAACGAATTCCACTATTCGTATGAGCCGTAGTAATTACAGTAGTACTTCTACTACTATCCCTTCCCGTACTTGCAGGAGCCATCACCATATTATTAACAGATCGAAACCTAAATACATCATTCTTCGACCCAGCAGGTGGTGGAGACCCTATTCTATATCAACACCTATTT

Back