Tax Names: Annelida, Clitellata, Haplotaxida, Megascolecidae, Perionyx

Taxon: Perionyx

Illustrative Barcode

Nucleotide Sequence

AACACTATACTTCATCCTCGGAGTTTGAGCAGGGATGGTCGGTGCAGGAATAAGACTCCTTATCCGAATCGAATTAAGCCAACCCGGAGCATTTTTAGGCAGGGATCAACTATATAATACAATTGTAACTGCACATGCTTTCTTAATAATTTTCTTTTTAGTTATACCAGTATTTATTGGTGGATTTGGAAACTGATTATTACCCCTAATACTGGGAGCACCAGACATGGCGTTCCCACGTCTAAATAACATAAGATTTTGATTGCTCCCCCCTTCATTAATCTTGTTAGTTTCTTCAGCAGCAGTAGAAAAGGGGGCAGGAACAGGTTGGACAGTATACCCACCACTTGCAAGAAATATTGCACATGCGGGCCCATCTGTAGACTTAGCCATTTTCTCACTTCATCTAGCAGGTGCATCATCAATTCTTGGGGCTATTAACTTCATTACTACAGTAATTAATATACGATGATCGGGATTACGCCTAGAACGAATTCCACTATTCGTATGGGCAGTCATTATTACTGTAGTACTTCTACTACTTTCTTTACCCGTGTTAGCAGGTGCTATTACCATGTTACTAACAGATCGAAATTTAAACACCTCATTTTTTGATCCAGCAGGAGGTGGAGATCCTATCCTATATCAACACCTATTC

Back