Tax Names: Annelida, Clitellata, Haplotaxida, Moniligastridae, Drawida, Drawida assamensis

Taxon: Drawida assamensis

Illustrative Barcode

Nucleotide Sequence

AACCCTATATTTTATCTTAGGCGTGTGAGCCGGAATAATTGGAGCCGGAATAAGACTATTAATTCGAATTGAACTGAGACAGCCCGGCTCATTTCTAGGTAGAGATCAACTTTATAATACAATTGTAACTGCTCACGCATTTATTATAATTTTCTTTCTTGTTATACCAGTATTTATTGGGGGATTTGGTAACTGACTTCTTCCCCTTATACTTGGAGCTCCTGATATAGCGTTTCCTCGGTTAAATAACTTAAGATTTTGATTGTTGCCCCCGGCACTAATCTTACTAGTTTCATCTGCTGCTGTAGAAAAAGGAGCAGGTACCGGGTGAACTGTATATCCGCCTTTAGCAAGAAACTTAGCCCATGCTGGACCATCGGTTGATTTAGCTATTTTCTCTCTTCACTTGGCCGGAGCGAGATCAATCTTGGGGGCCATCAACTTTATTACAACAGTAATTAATATACGATATCCTGGAATAACTATAGATCGAATTCCACTATTTGTCTGAGGAGTAGTAATTACAGTAGTATTACTACTACTATCACTACCAGTACTAGCAGGAGCTATTACTATACTTCTCACAGATCGAAATCTAAATACTTCTTTTTTCGACCCTGCTGGTGGTGGAGATCCAGTTCTCTATCAACACCTATTT

Back