Tax Names: Annelida, Clitellata, Haplotaxida, Moniligastridae, Drawida, Drawida gourensis

Taxon: Drawida gourensis

Illustrative Barcode

Nucleotide Sequence

AACTCTATATTTTATTCTCGGAGTTTGAGCCGGAATGATCGGGGCTGGGATGAGACTTCTCATTCGAGTTGAATTAAGACAGCCCGGCTCCTTCCTAGGAAGAGATCAATTATACAACACTATTGTAACTGCTCACGCATTTATTATAATTTTCTTTTTAGTAATGCCAGTATTTATTGGGGGATTTGGTAACTGACTTCTTCCACTTATACTCGGTGCCCCAGACATGGCTTTCCCCCGATTAAATAACCTAAGATTCTGATTACTGCCCCCCGCCTTAATCCTCCTGGTATCCTCAGCGGCTGTAGAGAAGGGGGCTGGAACCGGATGAACAGTATATCCACCACTAGCTAGAAATCTAGCCCATGCTGGACCGTCAGTTGATCTAGCAATTTTTTCACTTCACTTAGCAGGGGCCTCCTCTATTTTAGGAGCCATTAACTTTATTACAACAGTAGTTAATATACGTTGACCAGGTATAAGATGAGAACGAATTCCTCTATTCGTGTGAGGAGTTGTAATTACAGTAGTACTACTCCTCCTATCCCTACCTGTACTAGCTGGGGCTATTACTATGCTTCTAACAGATCGAAACCTTAATACATCCTTTTTTGATCCTGCGGGAGGAGGGGACCCCATCCTGTATCAACACCTATTC

Back